Download Shareware and Freeware Software for Windows, Linux, Macintosh, PDA

line Home  |  About Us  |  Link To Us  |  FAQ  |  Contact

Serving Software Downloads in 976 Categories, Downloaded 29.990.474 Times

gethgvbase 1.0

  Date Added: May 22, 2013  |  Visits: 228

gethgvbase

Report Broken Link
Printer Friendly Version


Product Homepage
Download (18 downloads)

GETHGVBASE returns polymorphism data from the human genome variation db http://hgvbase.cgb.ki.seHGVDATA = gethgvbase(SNPID) reads in a %hgvbase web record fromEMBL and creates a structure DATA %containing fields correspondingto the hgvBase keywords.FIELDNAME DESCRIPTIONS: a complete %description of field names can befound at: http://hgvbase.cgb.ki.se/cgi-bin/main.pl?p...data_struct.htm Examples: data = gethgvbase('SNP000003319') hgvData = gethgvbase('SNP000003320') Reference:HGVbase: a human sequence variation %database emphasizing dataquality and a broad spectrum of data %sources. Nucleic Acids Res. 2002 Jan1;30(1):387-91.See also:EMBLREAD, FASTAREAD, GENPEPTREAD, %GETGENBANK, SCFREAD, SEQTOOL.Colin Clarke, Cranfield University - %Analytical Science and Informatics$revision 1.0$ $Date: 12/09/2006$email: c.clarke.s03@cranfield.ac.ukdata = gethgvbase('SNP000003319')data = snpID: 'SNP000003319' varType: 'SNP' varStatus: 'Proven' geneType: 'Functional Gene' geneSymbol: 'COL4A4' geneName: 'collagen, type IV, alpha 4' geneRegion: 'I-Ex:CDS+' downStreamSequence: 'CCAGGACCAGGTATGAGCCGCATGC' upStreamSequence: 'TGGGGCTCCCTGGAATGAGAGGCCC' alleles: [2x1 char] sourceId: [2x12 char] DBXREFS: [3x21 char] citation: [2x41 char] feature: [14x12 char] motifChange: [] population: 'European, African and Middle East (90 individuals)' mesh: [25x31 char]

Requirements: No special requirements
Platforms: Matlab
Keyword: Analytical Clarke Col Cranfield Email Functional Gene Genesymbol Genetype Gethgvbase Snp Data Proven Science Seqtoolcolin Snp Snpid University Varstatus Vartype
Users rating: 0/10

License: Freeware Size: 10 KB
GETHGVBASE RELATED
Education  -  ErmineJ 2.1.21
ErmineJ performs analyses of gene sets in expression microarray data or other genome-wide data that results in rankings of genes. A typical goal is to determine whether particular biological pathways are "doing something interesting" in the data....
21.13 MB  
Business  -  GSA-SNP 1.0
GSA-SNP is a gene set analysis software that can process SNP data as well as gene and haplotype data.
245.76 KB  
Business  -  Barbados Yellow Pages 3.5.3
Search the Yellow Pages for businesses in your area or any city nationwide. Access business addresses, phone numbers, websites, email, ads, coupons and other enhanced listing data of our participating yellow page publishers. Sort by distance to...
9.2 MB  
Business  -  Emery Telcom 4.0
The Emery Telcom app will search the Yellow Pages for businesses in your area or any city nationwide. Access business addresses, phone numbers, websites, email, ads, coupons and other enhanced listing data of our participating yellow page...
17.7 MB  
Business  -  Enventis Online Directory 4.0.3
The Enventis app will search the Yellow Pages for businesses in your area or any city nationwide. Access business addresses, phone numbers, websites, email, ads, coupons and other enhanced listing data of our participating yellow page publishers....
9.1 MB  
Social Networking  -  Have I Been Pwned? 1.0.1.0
Pwn: from the verb own, as meaning to appropriate or to conquer, compromise or control. This app is a simple interface that queries HaveIBeenPwned.com to look up whether your email has shown up in recent prominent data breaches like Adobe,...
1024 KB  
Development Tools  -  dbSNP tool 1.0
dbSNPtool starts a GUI to return polymorphism data from dbSNPwww.ncbi.nih.gov/SNP Calling dbsnptool start the GUI, SNP % records are returned based on keyword. Each result is presented in a % listbox, clicking on the entry loads the sequence into...
40.96 KB  
Communication Tools  -  JPEE Email Utility (Mac OS X) 5. 3. 2002
A custom e-mail merge, email extractor, email verifier, data parser and all in one affordable email utility. JPEE is available as a free, easy to use, highly configurable, email communications software implementation. Use JPEE to extract / Import...
7.65 MB  
Modules  -  Simple Email Form 1.1.04
Lightweight email contact form with 9 configurable fields, including a configurable text area, a field for uploading attachments to the email, and a CAPTCHA based in Text_CAPTCHA from the PEAR library (included).Features* Six configurable fields:...
122.88 KB  
E-Mail Collectors  -  Email Verifier for Mac 1.0
Email Verifier is a web based email verification tool for email address verification services at affordable prices. Our email verifier service will help you clean your mailing list by validating each email you upload and verify email. Our 12...
360 KB  
NEW DOWNLOADS IN SCRIPTS, DEVELOPMENT TOOLS
Scripts  -  Free Ecommerce website creator 1.2
Free Ecommerce website creator is a free PHP shop creating script. This allows you to put a online shop on your own website. Create your own free ecommerce website for Your Business. Create an online shop using easyGUI online shop creator. The...
1.44 KB  
Scripts  -  MochiGames PHP Script ZDR 1.00
MochiGames PHP Script ZDR is web site, ready for use, for flash games. These flash games are downloaded automatically by "MochiGames PHP Script ZDR" from MochiGames media. The use of the games is free, you can use your own Mochi Publisher ID and...
368.54 KB  
Scripts  -  Php Chat 2.0
Add a free php site, single sign-on and multiple skins, 100% free 1. Server Modes: The chat server has paid mode and free mode. If the free chat mode, a free chat room will be assigned to your website with your domain as the room name. 2....
938.87 KB  
Scripts  -  Nibbleblog 3.0.1
Nibbleblog it's a powerful engine for creation and manipulation of BLOG's completely free. Very simple to install and configure (Only 1 step). The database used is based on XML files and this way it is not necessary to use MySQL or similar DBMS....
371.09 KB  
Scripts  -  PHP File Manager | CloudOsys 2.9b8
CloudOsys is a PHP file manager, a tool that allows your visitors upload files such as media content directly to your website. Your visitors will upload files directly to your website, where they can share and comment on them. Through cloud...
1.41 MB  
Development Tools  -  VMP Viewer 1.0
This is a very rudimentary tool to visualize the VMP files generated by BrainVoyager. Useful to share files with people who do not have BV.
10 KB  
Development Tools  -  7-Zip for Script 4.42
7-Zip is a file archiver with a high compression ratio.Features:- High compression ratio in new 7z format with LZMA compression- Supported formats:- Packing / unpacking: 7z, ZIP, GZIP, BZIP2 and TAR- Unpacking only: RAR, CAB, ISO, ARJ, LZH, CHM,...
624.64 KB  
Development Tools  -  PHP Docbook Displayer for Scripts 1.0b
PHP Docbook Displayer provides XSL and CSS stylesheets, and PHP scripts, to generate easily and dynamically websites from Docbook files.It aims at simplifying to the max the web publication process : simply drop the docbook file under the site root !
102.4 KB  
Development Tools  -  WP Translate 1.0
This simple language translation plugin allows your users to quickly translate your webpages, through a widget on your blog.You have the option to select the title of the Widget, which will be displayed above the language translation form. Users...
10 KB  
Development Tools  -  save2word 1.0
A simple function to copy figure from MATLAB into MS Word automatically. It is a modification of saveppt (a function in File exchange) that save figures to MS Powerpoint.
10 KB