gethgvbase 1.0

Date Added: May 22, 2013 | Visits: 368

Report Broken Link
Printer Friendly Version

Product Homepage
Download (43 downloads)

GETHGVBASE returns polymorphism data from the human genome variation db http://hgvbase.cgb.ki.seHGVDATA = gethgvbase(SNPID) reads in a %hgvbase web record fromEMBL and creates a structure DATA %containing fields correspondingto the hgvBase keywords.FIELDNAME DESCRIPTIONS: a complete %description of field names can befound at: http://hgvbase.cgb.ki.se/cgi-bin/main.pl?p...data_struct.htm Examples: data = gethgvbase('SNP000003319') hgvData = gethgvbase('SNP000003320') Reference:HGVbase: a human sequence variation %database emphasizing dataquality and a broad spectrum of data %sources. Nucleic Acids Res. 2002 Jan1;30(1):387-91.See also:EMBLREAD, FASTAREAD, GENPEPTREAD, %GETGENBANK, SCFREAD, SEQTOOL.Colin Clarke, Cranfield University - %Analytical Science and Informatics$revision 1.0$ $Date: 12/09/2006$email: c.clarke.s03@cranfield.ac.ukdata = gethgvbase('SNP000003319')data = snpID: 'SNP000003319' varType: 'SNP' varStatus: 'Proven' geneType: 'Functional Gene' geneSymbol: 'COL4A4' geneName: 'collagen, type IV, alpha 4' geneRegion: 'I-Ex:CDS+' downStreamSequence: 'CCAGGACCAGGTATGAGCCGCATGC' upStreamSequence: 'TGGGGCTCCCTGGAATGAGAGGCCC' alleles: [2x1 char] sourceId: [2x12 char] DBXREFS: [3x21 char] citation: [2x41 char] feature: [14x12 char] motifChange: [] population: 'European, African and Middle East (90 individuals)' mesh: [25x31 char]

Requirements: No special requirements

Platforms: Matlab

Keyword: Analytical, Clarke, Col, Cranfield, Email, Functional, Gene, Genesymbol, Genetype, Gethgvbase Snp Data, Proven, Science, Seqtoolcolin, Snp, Snpid, University, Varstatus, Vartype

Users rating: 0/10

License: Freeware

Size: 10 KB

USER REVIEWS

More Reviews or Write Review

GETHGVBASE RELATED

Education - ErmineJ 2.1.21 ErmineJ performs analyses of gene sets in expression microarray data or other genome-wide data that results in rankings of genes. A typical goal is to determine whether particular biological pathways are "doing something interesting" in the data....	21.13 MB
Development Tools - dbSNP tool 1.0 dbSNPtool starts a GUI to return polymorphism data from dbSNPwww.ncbi.nih.gov/SNP Calling dbsnptool start the GUI, SNP % records are returned based on keyword. Each result is presented in a % listbox, clicking on the entry loads the sequence into...	40.96 KB
Communication Tools - JPEE Email Utility (Mac OS X) 5. 3. 2002 A custom e-mail merge, email extractor, email verifier, data parser and all in one affordable email utility. JPEE is available as a free, easy to use, highly configurable, email communications software implementation. Use JPEE to extract / Import...	7.65 MB
Modules - Simple Email Form 1.1.04 Lightweight email contact form with 9 configurable fields, including a configurable text area, a field for uploading attachments to the email, and a CAPTCHA based in Text_CAPTCHA from the PEAR library (included).Features* Six configurable fields:...	122.88 KB
E-Mail Collectors - Email Verifier for Mac 1.0 Email Verifier is a web based email verification tool for email address verification services at affordable prices. Our email verifier service will help you clean your mailing list by validating each email you upload and verify email. Our 12...	360 KB
Communication Tools - JPEE Email Utility X 5.3.2 JPEE Email Utility is available as a free email extractor, email verifier, email mailer, email parser, email exporter, and email merge software solution. Take the bulk out of your email.Features include: Complete Email Merge Solution Unlimited...
E-Mail Tools - Yukatan data model 1.0 Yukatan data model project is the schema definition of the Yukatan webmail database. The PostgreSQL database structures defined in this file can be used as a backend store of an email message handling application. The database should be created...	35.84 KB
Form Processors - phpFormGenerator 3.0b 1.0 phpFormGenerator is an easy-to-use tool to create reliable and efficient web forms in a snap. No programming of any sort is required. Just follow along the phpFormGenerator wizard and at the end, you will have a fully functional web form!Program...
Utilities - Inforama 1.5 Inforama will allow you to import existing Acrobat forms and create letter templates using OpenOffice. Merge data to produce high quality PDF documents and automatically email, print and view. Here are some key features of...	51.3 MB
Text Editors - Inforama 1.2 GA 1 / 1.3 Beta 2 1.4 GA 2 / 1.5 Inforama 1.2 GA 1 / 1.3 Beta 2 Inforama - document templates, generation and distribution. Create letter templates using OpenOffice and import existing Acrobat forms. Merge data to produce high quality PDF documents and automatically...	51.17 MB

NEW DOWNLOADS IN SCRIPTS, DEVELOPMENT TOOLS

Scripts - Free Ecommerce website creator 1.2 Free Ecommerce website creator is a free PHP shop creating script. This allows you to put a online shop on your own website. Create your own free ecommerce website for Your Business. Create an online shop using easyGUI online shop creator. The...	1.44 KB
Scripts - MochiGames PHP Script ZDR 1.00 MochiGames PHP Script ZDR is web site, ready for use, for flash games. These flash games are downloaded automatically by "MochiGames PHP Script ZDR" from MochiGames media. The use of the games is free, you can use your own Mochi Publisher ID and...	368.54 KB
Scripts - Php Chat 2.0 Add a free php site, single sign-on and multiple skins, 100% free 1. Server Modes: The chat server has paid mode and free mode. If the free chat mode, a free chat room will be assigned to your website with your domain as the room name. 2....	938.87 KB
Scripts - Nibbleblog 3.0.1 Nibbleblog it's a powerful engine for creation and manipulation of BLOG's completely free. Very simple to install and configure (Only 1 step). The database used is based on XML files and this way it is not necessary to use MySQL or similar DBMS....	371.09 KB
Scripts - PHP File Manager \| CloudOsys 2.9b8 CloudOsys is a PHP file manager, a tool that allows your visitors upload files such as media content directly to your website. Your visitors will upload files directly to your website, where they can share and comment on them. Through cloud...	1.41 MB
Development Tools - Aml2CHM 3.50 Those who use the popular Aml Pages text editor might be looking out for a way of generating help files from their text and notes. Aml2CHM is a plug-in that was developed to offer people a quick and efficient way of converting Aml Pages documents...	549.99 KB
Development Tools - VMP Viewer 1.0 This is a very rudimentary tool to visualize the VMP files generated by BrainVoyager. Useful to share files with people who do not have BV.	10 KB
Development Tools - 7-Zip for Script 4.42 7-Zip is a file archiver with a high compression ratio.Features:- High compression ratio in new 7z format with LZMA compression- Supported formats:- Packing / unpacking: 7z, ZIP, GZIP, BZIP2 and TAR- Unpacking only: RAR, CAB, ISO, ARJ, LZH, CHM,...	624.64 KB
Development Tools - PHP Docbook Displayer for Scripts 1.0b PHP Docbook Displayer provides XSL and CSS stylesheets, and PHP scripts, to generate easily and dynamically websites from Docbook files.It aims at simplifying to the max the web publication process : simply drop the docbook file under the site root !	102.4 KB
Development Tools - WP Translate 1.0 This simple language translation plugin allows your users to quickly translate your webpages, through a widget on your blog.You have the option to select the title of the Widget, which will be displayed above the language translation form. Users...	10 KB

Windows Software	BeOS Software
Macintosh Software	Linux Software
PDA Software	OS/2 Software
Mobile Software	Scripts